Listeria monocytogenes non-coding RNA explained

Listeria snRNA rli22
Width:	200
Symbol:	rli22
Rfam:	RF01457
Rna Type:	gene, snRNA
Tax Domain:	Listeria

Listeria monocytogenes is a gram positive bacterium and causes many food-borne infections such as Listeriosis. This bacteria is ubiquitous in the environment where it can act as either a saprophyte when free living within the environment or as a pathogen when entering a host organism. Many non-coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non-coding RNAs and may contribute to pathogenesis.^[1]

Tiling arrays and mutagenesis identified many non-coding RNAs within the L. monocytogenes genome and the location of these non-coding RNAs within the bacterial genome was confirmed by RACE (rapid amplification of cDNA ends) analysis. These studies showed that the expression of many non-coding RNAs was dependent on the environment and that several of these non-coding RNAs act as cis-regulatory elements. Comparisons between previously characterized non-coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non-coding RNAs in L. monocyotogenes. An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non-coding RNAs that are only present within L. monocytogenes which suggests that these ncRNAs may have a role in pathogenesis.^[2] The tables below summarizes the location, flanking genes and also the characteristics of the novel small non-coding RNAs identified and the previously characterized non-coding RNAs present in L. monocytogenes

Novel Non-coding RNAs

ID	Start	Stop	Size	5′ flanking gene	sense of the gene on the genome	^a		3′ flanking gene	Characteristic	Rfam
rli22	31997	32107	110	lmo0028	->	->	->	lmo0029	sRNA
rli23	172171	172268	97	lmo0172	<-	->			sRNA Antisense to lmo0172 transposase Homolog of rli25 and rli35.
rli24	271029	271186	157	lmo0256	->	->	->	lmo0257	sRNA
rli25	357618	357516	102	lmo0330	->	<-			sRNA Antisense to lmo0330: transposase. Homolog of rli23 and rli35
rli26	388707	388520	187	lmo0360	->	<-	<-	lmo0361	sRNA
rli27	434831	434929	98	lmo0411	<-	->	<-	lmo0412	sRNA
rli28	507394	507206	188	lmo0470	->	<-	->	lmo0471	sRNA Homolog of rli50
rli29	507643	507450	193	lmo0470	->	<-	->	lmo0471	sRNA Antisense to the 5'UTR of lmo0471
rli30	540785	540670	115	lmo0506	->	<-			sRNA Antisense to lmo0506
rli31	597812	597926	114	lmo0558	<-	->	->	lmo0559	Required for lysozyme resistance and pathogenesis.^[3] Structure characterized as two long hairpins. Interacts with the RNA binding global regulator SpoVG.^[4]
rli32	600750	600604	147	lmo0560	<-	<-	<-	lmo0561	sRNA
rli33	708326	708860	534	lmo0671	->	->	->	lmo0672	sRNA
rli34	803031	802948	83	lmo0777	->	<-	->	lmo0778	sRNA
rli35	855495	855393	102	lmo0828	->	<-			sRNA Antisense to lmo0828: transposase. Homolog of rli23 and rli25
rli36	859527	859444	83	nifJ	->	<-	<-	fbp	sRNA
rli37	907576	907832	256	lmo0866	->	->	->	lmo0867	ORF ORF of 58aa. RBS region: TGATACGGGAGTGTGGTGCTAGTTATG
rli38	1152549	1152917	369	lmo1115	<-	->	->	lmo1116	sRNA role in virulence
rli39	1179807	1179993	187	lmo1149	->	->	<-	lmo1150	sRNA Annotated as a cobalamin riboswitch in Rfam
rli40	1275810	1275547	264	lmo1251	->	<-	<-	lmo1252	ORF ORF of 64 aa. RBS region: AGTGAGGCGTCCTTATG
rli41	1277207	1276713	495	lmo1252	<-	<-	->	lmo1253	Two ORFs ORF of 45 aa. RBS region: AGAGGAGGTATTTTCTATG ORF of 35 aa. RBS region:AAGGAGGAAAACAAATTG
rli42	1399617	1399447	171	lmo1374	->	<-	->	lmo1375	sRNA
rli43	1861630	1861377	253	inlC	<-	<-	<-	rplS	ORF ORF of 35aa. RBS region: AGAGTGAGGTGTAATATG
rli44	2039087	2039375	289	lmo1964	<-	->	<-	lmo1965	ORF ORF of 28aa. RBS region: GGAAAGGATAACCCATG
rli45	2154775	2154852	77	lmo2074	->	->	<-	lmo2075	sRNA Antisense to rli46
rli46	2155058	2154765	294	lmo2074	->	<-	<-	lmo2075	sRNA Antisense to rli45
rli47	2226024	2226532	508	lmo2141	->	->	<-	lmo2142	sRNA
rli48	2361423	2361274	149	lmo2271	<-	<-	->	lmo2272	sRNA
rli49	2660179	2660364	185	lmo2579	->	->	<-	lmo2580	sRNA
rli50	2783274	2783098	176	lmo2709	->	<-	<-	lmo2710	sRNA Homolog of rli28
rli51	207589	207709	120	hly	->	->	->	mpl	5′-UTR-derived Increased in intestinal lumen
rli52	552421	552327	94	lmo0517	<-	<-	<-	lmo0518	5′-UTR-derived Putative riboswitch.
rli53	955829	956001	172	lmo0918	->	->	->	lmo0919	5′-UTR-derived Putative riboswitch.
rli54	1078584	1079111	527	lmo1051	<-	->	->	pdhA	5′-UTR-derived Putative riboswitch.
rli55	1198107	1198389	282	lmo1170	->	->	->	pduQ	5′-UTR-derived Putative riboswitch.
rli56	1199859	1199958	99	pduQ	->	->	->	lmo1172	5′-UTR-derived Putative riboswitch.
rli57	?	1216658	?	lmo1190	->	->	->	cbiA	3′-UTR-derived Annotated as a cobalamin riboswitch in Rfam lmo1190-rli57 transcript levelncreasedinintestinal lumen
rli58	?	1639974	?	rpsD	->	<-	<-	lmo1597	3′-UTR-derived
rli59	1702553	1702373	180	lmo1652	<-	<-	<-	lmo1653	5′-UTR-derived
rli60	2054124	2054308	184	lmo1982	<-	->	->	ilvD	5′-UTR-derived Putative riboswitch.
rli61	2275363	2275258	106	lmo2187	<-	<-	<-	lmo2188	5′-UTR-derived Putative riboswitch
rli62	2364508	2364337	172	lmo2277	<-	<-	<-	lmo2278	5′-UTR-derived Putative riboswitch.
rli63	2613301	?	?	atpI	<-	<-	<-	lmo2537	5′-UTR-derived Putative riboswitch
rliA	513584	513807	224	lmo0476	<-	>-	>-	lmo0477	snRNA
rliB	544357	544716	360	lmo0509	->	->	->	lmo0510	sRNA
rliC	1154309	1154671	363	lmo1117	->	->	<-	lmo1118	sRNA
rliD	1359529	1359202	328	rpsO	->	<-	->	pnpA	sRNA antisense
rliE	1584586	1584808	223	comC	<-	->	<-	folC	sRNA antisense to comC mRNA
rliF	2106292	2106073	220	nadA	->	<-	<-	lmo2026	snRNA
rliG	2386992	2386715	278	lmo2302	<-	<-	<-	lmo2303	sRNA
rliH	1180826	1181254	429	lmo1150	<-	->	->	lmo1151	sRNA antisense
rliI	2842200	2841962	239	lmo2760	<-	<-	->	lmo2761	sRNA
sbrA^[5]	1399363	1399433	70	lmo1374	->	->	->	lmo1375	sRNA

^aArrows indicate the sense of the gene on the genome. Bold arrows indicate gene absent from L. innocua.

Listeria monocytogenes EGD-e strain was used in these studies EMBL accession AL591824.1

Characterised non-coding RNAs

ID Rfam RF00162 RF00616 RF00059 RF00234 RF00522 RF00230 RF00013

ID Rfam RF00558 RF00050 RF00023 RF00169 RF00038 RF00557 RF00167

ID Rfam RF00168 RF00080 RF00504 RF00559 RF00515 RF00615 RF00555

External links

• Rfam database

Notes and References

1. Mandin P, Repoila F, Vergassola M, Geissmann T, Cossart P . Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets . Nucleic Acids Res. . 35 . 3 . 962–974 . 2007 . 17259222 . 1807966 . 10.1093/nar/gkl1096 .
2. Toledo-Arana A, Dussurget O, Nikitas G, etal . The Listeria transcriptional landscape from saprophytism to virulence . Nature . 459 . 7249 . 950–956 . June 2009 . 19448609 . 10.1038/nature08080 .
3. Burke TP, Loukitcheva A, Zemansky J, Wheeler R, Boneca IG, Portnoy DA . Listeria monocytogenes is resistant to lysozyme through the regulation, not the acquisition, of cell wall-modifying enzymes . J. Bacteriol. . 196 . 21 . 3756–3767 . 2014 . 25157076 . 4248804 . 10.1128/JB.02053-14 .
4. Burke TP, Portnoy DA . SpoVG Is a Conserved RNA-Binding Protein That Regulates Listeria monocytogenes Lysozyme Resistance, Virulence, and Swarming Motility . mBio . 7 . 2 . 2016 . 27048798 . 4959528 . 10.1128/mBio.00240-16 .
5. 10.1128/JB.00740-08 . Nielsen JS, Olsen AS, Bonde M, Valentin-Hansen P, Kallipolitis BH . Identification of a sigma B-dependent small noncoding RNA in Listeria monocytogenes. . J Bacteriol . 190 . 18 . 6264–6270 . 2008 . 18621897 . 2546787.