Human identical sequence explained

The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome. In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes.^[1] ^[2] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five.^[3] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats).^[3]

SARS-CoV-2

name	length	sequence	location in virus genome	location in human genome	note
HIS-SARS2-1	26	UGUCUAUGCUAAUGGAGGUAAAGGCU		Chr3 124017420-124017395
HIS-SARS2-2	24	UAUAACACAUATAAAAAUACGUGU	12494–12517 in ORF1a	Chr3 176597319-176597342
HIS-SARS2-3	24	UUAUAUGCCUUAUUUCUUUACUUU	6766–6789 in ORF1a	Chr5 28949255-28949232
HIS-SARS2-4	27	AGGAGAAUGACAAAAAAAAAAAAAAAA		Chr18 73670168-73670142	same as HIS-SARS1-2
HIS-SARS2-5	24	UUGUUGCUGCUAUUUUCUAUUUAA	8610–8633 in ORF1a	ChrX 99693480-99693457

SARS-CoV-1

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-SARS-1	25	UAACAUGCUUAGGAUAAUGGCCUCU		Chr4 172887105–172887129 Chr8: 122356667-122356690
HIS-SARS-2	27	AGGAGAAUGACAAAAAAAAAAAAAAAA		Chr18 73670168-73670142		same as HIS-SARS2-4

HCoV-HKU1

name	length	sequence	location in virus genome	location in human genome
HIS-HKU1-1	24	UUAGAAUUGUUCAAAUGUUAUCUG	18656-18679	chr1 106816197-106816220
HIS-HKU1-2	24	UUUUCUAAGAAAGAUUGGUAUGAU	14044-14067	chr1 226438633-226438656 chr4:151100495-151100518 chr5:79284823-79284846 chr5:111192947-111192970 chr7:94695722-94695745 chr7:98386489-98386512 chr15:59768424-59768447 chr22:30137367-30137390
HIS-HKU1-3	24	AUUUGACUUUAAAUCUUCAUACUA	26693-26716	chr4 11718458-11718481
HIS-HKU1-4	24	GAUUGGUUGUAUUUUCAUUUUUAU	23527-23550	chr4 33759646-33759669
HIS-HKU1-5	24	UAGAUACUGUUAUUUUUAAAAAUA	19844-19867	chrX 81711130-81711153

HCoV-NL63

name	length	sequence	location in virus genome	location in human genome
HIS-NL63-1	24	UUAUGAUUUUGGUGAUUUUGUUGU	13044-13067	chr1 215311768-215311791
HIS-NL63-2	24	GGUGUUUUUGUUGAUGAUGUUGUU	14920-14943	chr4 28254452-28254475
HIS-NL63-3	24	AUAGGCUUAAAUGCUUCUGUUACU	20754-20777	chr6 30469931-30469954
HIS-NL63-4	24	AAGUAAUUGUAUUAAGAUGUUAUC	12124-12147	chr7 19853545-19853568
HIS-NL63-5	24	AACUUUUAUGAUUUUGGUGAUUUU	13039-13062	chr9 1525276-1525299

HCoV-OC43

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-OC43-1	24	UACAGCUCUUUGUAAAUCUGGUAG	22827-22850	chr8 122471006-122471029	HAS2, ZHX2
HIS-OC43-2	24	UUGUAUGAGUGAUUUUAUGAGUGA	24509-24532	chr13 30510223-30510246

HCoV-229E

name	length	sequence	location in virus genome	location in human genome	neighboring genes	note
HIS-229E-1	24	AAUAUUUUAACAGUACCACGUUAU	19817-19840	chr8 42865576-42865599
HIS-229E-2	24	ACUUUGUAUUGUGUCCUCCUGGAA	13139-13162	chr11 112451251-112451274

Notes and References

Yang . S . Ling . Y . Zhao . F . Li . W . Song . Z . Wang . L . Li . Q . Liu . M . Tong . Y . Chen . L . Ru . D . Zhang . T . Zhou . K . Zhang . B . Xu . P . Yang . Z . Li . W . Song . Y . Xu . J . Zhu . T . Shan . F . Yu . W . Lu . H . Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression. . Signal Transduction and Targeted Therapy . 18 March 2022 . 7 . 1 . 91 . 10.1038/s41392-022-00952-w . 35304437. 8931182 .
Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W . MicroRNAs activate gene transcription epigenetically as an enhancer trigger . RNA Biology . 14 . 10 . 1326–1334 . October 2017 . 26853707 . 5711461 . 10.1080/15476286.2015.1112487 .
Li . W . Yang . S . Xu . P . Zhang . D . Tong . Y . Chen . L . Jia . B . Li . A . Lian . C . Ru . D . Zhang . B . Liu . M . Chen . C . Fu . W . Yuan . S . Gu . C . Wang . L . Li . W . Liang . Y . Yang . Z . Ren . X . Wang . S . Zhang . X . Song . Y . Xie . Y . Lu . H . Xu . J . Wang . H . Yu . W . SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network. . EBioMedicine . February 2022 . 76 . 103861 . 10.1016/j.ebiom.2022.103861 . 35124429. 8811534 .