Haplogroup I-M253 Explained

I1 (M253)
Origin-Date:3,170–4,600[1] –5,070 BP (today's diversification)[2] [3] (previously 11,000 BP[4] to 33,000 BP[5])27,500 (diversification with I2-FGC77992)
Origin-Place:Northern Europe[6]
Ancestor:I* (M170)
Descendants:I1a (DF29/S438);
I1b (S249/Z131);
I1c (Y18119/Z17925)
Mutations:M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187

Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187. It is a primary branch of Haplogroup I-M170 (I*).

Haplogroup I1 is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-Neolithic DNA samples it cannot have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the Nordic Bronze Age. Today it reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province).[7] In terms of national averages, I-M253 is found in 38-39% of Swedish males,[8] [9] [7] 37% of Norwegian males,[10] [11] [12] 34.8% of Danish males,[13] [14] 34.5% of Icelandic males,[15] [16] [17] and about 28% of Finnish males.[18] Bryan Sykes, in his 2006 book Blood of the Isles, gives the members – and the notional founding patriarch of I1 the name "Wodan".[19]

All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.[1]

Before a reclassification in 2008,[20] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).

More than 99% of living men with I1 belong to the DF29 branch which is estimated to have emerged in 2400 BCE.[21] [22] All DF29 men share a common ancestor born between 2500 and 2400 BCE.[23] The oldest ancient individual with I1-DF29 found is Oll009, a man from early Bronze Age Sweden.[24] [25]

Origins

While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far DNA studies have only been able to locate it in three Paleolithic and Mesolithic hunter-gatherers. As of November 2022, only 6 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:

Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia[37] [38] [29] (which also is the case with other haplogroups across Europe). Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age.[33] [39] [40]

Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the Battle Axe culture, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the Funnelbeaker culture in Central Europe; or the steppe itself. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.

Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2600 BC.

According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe.[2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.[3]

In 2007, it was suggested that it initially dispersed from the area that is now Denmark.[41] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".

Latest results (January 2022) published by Y-Full suggest I1 (I-M253) was formed 27,500 ybp (95 CI: 29,800 ybp – 25,200 ybp) with TMRCA 4,600 ybp (95 CI: 5,200 ybp – 4,000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2600 BC, this likely puts the ancestor of all living I1 men somewhere in Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion.[42] [43] This suggests that I1 went from being a rare marker to a rather common one in a rapid burst.[3]

Structure

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [44]

Historical expansion

Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age.[45] [46] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanic peoples migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths.[47]

I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237.[48] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore, the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy.[49] [50] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.

In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300–400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.[51]

Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234.[52] Material findings associated with the Lombards have been excavated in Crypta Balbi.

The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1.[53] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.

The Anglo-Saxon settlement of Britain introduced I1 in the British Isles.[54]

During the Viking Age, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.[55]

Geographical distribution

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.

During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia, New Zealand and Canada.

PopulationSample sizeI (total)I1 (I-M253)I1a1a (I-M227)Source
Albanians (Tirana) 55 21.82%=(12/55) 3.6%=(2/55) 0.0 Battaglia et al. 2008
Albanians (North Macedonia) 64 17.2%=(11/64) 4.7%=(3/64) 0.0 Battaglia et al. 2008
Albanians (Tirana)
Albanians (North Macedonia) 		55+64=119 19.33%=(23/119) 4.2%=(5/119) 0.0 Battaglia et al. 2008
Kosovo Albanians (Pristina) 114 7.96%=(9/114) 5.31%=(6/114) 0.0 Pericic et al. 2005
Albanians (Tirana)
Albanians (North Macedonia)
Kosovo Albanians (Pristina) 		55+64+114=233 13.73%=(32/233) 4.72%=(11/233) 0.0 Pericic et al. 2005
Battaglia et al. 2008
Austria 43 9.3 2.3 0.0 Underhill et al. 2007
Belarus: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
Belarus: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
Czech Republic 47 31.9 8.5 0.0 Underhill et al. 2007
Czech Republic 53 17.0 1.9 0.0 Rootsi et al. 2004
Denmark 122 39.3% (48/122) 34.8% (40/122) 0.0 Underhill et al. 2007
England 104 19.2 15.4 0.0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 11.9 Lappalainen et al. 2008
Finland (national) 28.0 Lappalainen et al. 2006
Finland: West 230 40% (92/230) Lappalainen et al. 2008
Finland: East 306 19% (58/306) Lappalainen et al. 2008
Finland: Satakunta region 50+ Lappalainen et al. 20089
France 58 17.2 8.6 1.7 Underhill et al. 2007
France 12 16.7 16.7 0.0 Cann et al. 2002
France (Low Normandy) 42 21.4 11.9 0.0 Rootsi et al. 2004
Germany 125 24 15.2 0.0 Underhill et al. 2007
Greece 171 15.8 2.3 0.0 Underhill et al. 2007
Hungary 113 25.7 13.3 0.0 Rootsi et al. 2004
Ireland 100 11 6.0 0.0 Underhill et al. 2007
53 13.2 11.3 0.0 Trofimova 2015
Latvia 113 3.5 Lappalainen et al. 2008
Lithuania 164 4.9 Lappalainen et al. 2008
Netherlands 93 20.4 14 0.0 Underhill et al. 2007
Norway 1766 37% (653/1766) Stenersen et al. 2006
Russia (national) 16 25 12.5 0.0 Cann et al. 2002
Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
Russia: Cossacks 89 24.7 4.5 0.0 Underhill et al. 2007
Russia: Karelians 140 10 8.6 0.0 Underhill et al. 2007
Russia: Karelians 132 15.2 Lappalainen et al. 2008
Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
Slovakia 70 14.3 4.3 0.0 Rootsi et al. 2004
Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
Sweden (national) 160 35.6% (57/160) Lappalainen et al. 2008
Sweden (national) 38.0 Lappalainen et al. 2009
Sweden: Västra Götaland 52 Lappalainen et al. 2009
Switzerland 144 7.6 5.6 0.0 Rootsi et al. 2004
Turkey 523 5.4 1.1 0.0 Underhill et al. 2007
Ukraine: Lviv 101 23.8 4.9 0.0 Underhill et al. 2007
Ukraine: Ivanovo-Frankiv 56 21.4 1.8 0.0 Underhill et al. 2007
Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
114 28.1 4.3 0.0 Underhill et al. 2007
Ukraine: Bilhorod 56 26.8 5.3 0.0 Underhill et al. 2007

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[56] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number ... This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea ... These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[57] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Prominent members of I-M253

See main article: List of haplogroups of historical and famous figures.

Through direct testing or testing of their descendants and genealogical evidence, the following notable people have been shown to be I-M253:

Markers

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253[99]

Type: SNP

Source: M (Peter Underhill of Stanford University)

Position: ChrY:13532101..13532101 (+ strand)

Position (base pair): 283

Total size (base pairs): 400

Length: 1

ISOGG HG: I1

Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG

Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT

YCC HG: I1

Nucleotide alleles change (mutation): C to T

Name: M307[100]

Type: SNP

Source: M (Peter Underhill)

Position: ChrY:21160339..21160339 (+ strand)

Length: 1

ISOGG HG: I1

Primer F: TTATTGGCATTTCAGGAAGTG

Primer R: GGGTGAGGCAGGAAAATAGC

YCC HG: I1

Nucleotide alleles change (mutation): G to A

Name: P30[101]

Type: SNP

Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)

Position: ChrY:13006761..13006761 (+ strand)

Length: 1

ISOGG HG: I1

Primer F: GGTGGGCTGTTTGAAAAAGA

Primer R: AGCCAAATACCAGTCGTCAC

YCC HG: I1

Nucleotide alleles change (mutation): G to A

Region: ARSDP

Name: P40[102]

Type: SNP

Source: PS (Michael Hammer and James F. Wilson)

Position: ChrY:12994402..12994402 (+ strand)

Length: 1

ISOGG HG: I1

Primer F: GGAGAAAAGGTGAGAAACC

Primer R: GGACAAGGGGCAGATT

YCC HG: I1

Nucleotide alleles change (mutation): C to T

Region: ARSDP

See also

Further reading

External links

Haplogroup I databases
General Y-DNA databasesThere are several public access databases featuring I-M253, including:
  1. http://www.ysearch.org/
  2. YHRD : Y-Chromosome STR Haplotype Reference Database
  3. I1 YTree

Notes and References

  1. Web site: I1 YTree . Yfull.com . 2022-04-06 . 2022-04-19.
  2. Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  3. Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, Arroyo-Pardo E, Cavalleri GL, de Knijff P, Dupuy BM, Eriksen HA, King TE, de Munain AL, López-Parra AM, Loutradis A, Milasin J, Novelletto A, Pamjav H, Sajantila A, Tolun A, Winney B, Jobling MA . 6 . Large-scale recent expansion of European patrilineages shown by population resequencing . Nature Communications . 6 . 7152 . May 2015 . 25988751 . 4441248 . 10.1038/ncomms8152 . 2015NatCo...6.7152B .
  4. Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, Kutuev I, Barać L, Pericić M, Balanovsky O, Pshenichnov A, Dion D, Grobei M, Zhivotovsky LA, Battaglia V, Achilli A, Al-Zahery N, Parik J, King R, Cinnioğlu C, Khusnutdinova E, Rudan P, Balanovska E, Scheffrahn W, Simonescu M, Brehm A, Goncalves R, Rosa A, Moisan JP, Chaventre A, Ferak V, Füredi S, Oefner PJ, Shen P, Beckman L, Mikerezi I, Terzić R, Primorac D, Cambon-Thomsen A, Krumina A, Torroni A, Underhill PA, Santachiara-Benerecetti AS, Villems R, Semino O . 6 . Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe . American Journal of Human Genetics . 75 . 1 . 128–37 . July 2004 . 15162323 . 1181996 . 10.1086/422196 . 2008-03-20 . dead . https://web.archive.org/web/20090624135411/http://www.familytreedna.com/pdf/DNA.RootsiHaplogroupISpread.pdf . 2009-06-24 .
  5. Book: Underhill PA, Myres NM, Rootsi S, Chow CT, Lin AA, Otillar RP, King R, Zhivotovsky LA, Balanovsky O, Pshenichnov A, Ritchie KH . 6 . New phylogenetic relationships for Y-chromosome haplogroup I: reappraising its phylogeography and prehistory. . Mellars P, Boyle K, Bar-Yosef O, Stringe C . Rethinking the Human Revolution. . Cambridge, UK . McDonald Institute Monographs . 2007 . 33–42 . 978-1-902937-46-5 .
  6. 10.1111/j.1469-1809.2007.00429.x . Migration Waves to the Baltic Sea Region . 2008 . Lappalainen . T. . Laitinen . V. . Salmela . E. . Andersen . P. . Huoponen . K. . Savontaus . M.-L. . Lahermo . P. . Annals of Human Genetics . 72 . 3 . 337–348 . 18294359 . 32079904 . free .
  7. Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P . Migration waves to the Baltic Sea region . Annals of Human Genetics . 72 . Pt 3 . 337–348 . May 2008 . 18294359 . 10.1111/j.1469-1809.2007.00429.x . 32079904 . free .
  8. Lappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, Savontaus ML, Kere J, Lahermo P . 6 . Population structure in contemporary Sweden—a Y-chromosomal and mitochondrial DNA analysis . Annals of Human Genetics . 73 . 1 . 61–73 . January 2009 . 19040656 . 10.1111/j.1469-1809.2008.00487.x . 205598345 .
  9. Web site: FamilyTreeDNA – Sweden DNA PROJECT – Sverigeprojektet.
  10. Dupuy BM, Stenersen M, Lu TT, Olaisen B . Geographical heterogeneity of Y-chromosomal lineages in Norway . Forensic Science International . 164 . 1 . 10–19 . December 2006 . 16337760 . 10.1016/j.forsciint.2005.11.009 .
  11. Web site: FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet. 2020-11-26. familytreedna.com.
  12. Web site: Y-DNA Haplogrupper. 2020-12-27. Norway DNA Norgesprosjektet.
  13. Sanchez JJ . 2004. Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis. International Congress Series. 1261. 347–49. 10.1016/S0531-5131(03)01635-2. isfg.org.
  14. Web site: FamilyTreeDNA – Denmark DNA Project. 2020-12-10. familytreedna.com.
  15. Helgason A, Sigureth ardóttir S, Nicholson J, Sykes B, Hill EW, Bradley DG, Bosnes V, Gulcher JR, Ward R, Stefánsson K . 6 . Estimating Scandinavian and Gaelic ancestry in the male settlers of Iceland . American Journal of Human Genetics . 67 . 3 . 697–717 . September 2000 . 10931763 . 1287529 . 10.1086/303046 .
  16. Web site: April 2021. The Greater Nordic Regional Y-DNA Project. familytreedna.
  17. Ebenesersdóttir SS, Sandoval-Velasco M, Gunnarsdóttir ED, Jagadeesan A, Guðmundsdóttir VB, Thordardóttir EL, Einarsdóttir MS, Moore KH, Sigurðsson Á, Magnúsdóttir DN, Jónsson H, Snorradóttir S, Hovig E, Møller P, Kockum I, Olsson T, Alfredsson L, Hansen TF, Werge T, Cavalleri GL, Gilbert E, Lalueza-Fox C, Walser JW, Kristjánsdóttir S, Gopalakrishnan S, Árnadóttir L, Magnússon ÓÞ, Gilbert MT, Stefánsson K, Helgason A . 6 . Ancient genomes from Iceland reveal the making of a human population . Science . 360 . 6392 . 1028–1032 . June 2018 . 29853688 . 10.1126/science.aar2625 . free . 2018Sci...360.1028E . 10852/71890 . free .
  18. Lappalainen T, Koivumäki S, Salmela E, Huoponen K, Sistonen P, Savontaus ML, Lahermo P . Regional differences among the Finns: a Y-chromosomal perspective . Gene . 376 . 2 . 207–15 . July 2006 . 16644145 . 10.1016/j.gene.2006.03.004 .
  19. Web site: 2013-02-22. Blood of the Isles: exploring the genetic roots of our tribal history. 2020-12-10. History Ireland.
  20. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF . New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree . Genome Research . 18 . 5 . 830–38 . May 2008 . 18385274 . 2336805 . 10.1101/gr.7172008 .
  21. Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, Arroyo-Pardo E, Cavalleri GL, de Knijff P, Dupuy BM, Eriksen HA, King TE, de Munain AL, López-Parra AM, Loutradis A, Milasin J, Novelletto A, Pamjav H, Sajantila A, Tolun A, Winney B, Jobling MA . 6 . Large-scale recent expansion of European patrilineages shown by population resequencing . Nature Communications . 6 . 1 . 7152 . May 2015 . 25988751 . 10.1038/ncomms8152 . 4441248 . 2015NatCo...6.7152B .
  22. Web site: Welcome to FamilyTreeDNA Discover (Beta) . 2022-12-25 . FamilyTreeDNA Discover (Beta).
  23. Web site: I-DF29 YTree . 2022-12-25 . yfull.com.
  24. Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, Pospieszny Ł, Tõrv M, Lindström J, Götherström A, Storå J, Jakobsson M . 6 . The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon . Proceedings. Biological Sciences . 286 . 1912 . 20191528 . October 2019 . 31594508 . 6790770 . 10.1098/rspb.2019.1528 .
  25. Web site: I-Y11204 YTree . 2022-12-25 . yfull.com.
  26. Web site: Haplotree.info – ancientdna.info. Map based on All Ancient DNA v. 2.07.26. .
  27. Gunther T . 2017. Genomics of Mesolithic Scandinavia reveal colonization routes and high-latitude adaptation. Nature. 23. 6. Biorxiv.
  28. Web site: SF11 – Stora Förvar, Stora Karlsö I-Z2699*. Haplotree.info sample: SF11. haplotree.info.
  29. Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, Hall P, Tambets K, Parik J, Sjögren KG, Apel J, Willerslev E, Storå J, Götherström A, Jakobsson M . 6 . Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers . Science . 344 . 6185 . 747–50 . May 2014 . 24762536 . 10.1126/science.1253448 . 206556994 . 2014Sci...344..747S . free .
  30. Web site: April 2021. familytreedna.com I-Z2699 tree. familytreedna.
  31. Szécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, Köhler K, Mende BG, Oross K, Marton T, Osztás A, Kiss V, Fecher M, Pálfi G, Molnár E, Sebők K, Czene A, Paluch T, Šlaus M, Novak M, Pećina-Šlaus N, Ősz B, Voicsek V, Somogyi K, Tóth G, Kromer B, Bánffy E, Alt KW . 6 . Tracing the genetic origin of Europe's first farmers reveals insights into their social organization . Proceedings. Biological Sciences . 282 . 1805 . April 2015 . 25808890 . 4389623 . 10.1098/rspb.2015.0339 .
  32. Web site: BAB5 I-Z2699*. haplotree.info.
  33. Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, Damgaard PB, Schroeder H, Ahlström T, Vinner L, Malaspinas AS, Margaryan A, Higham T, Chivall D, Lynnerup N, Harvig L, Baron J, Della Casa P, Dąbrowski P, Duffy PR, Ebel AV, Epimakhov A, Frei K, Furmanek M, Gralak T, Gromov A, Gronkiewicz S, Grupe G, Hajdu T, Jarysz R, Khartanovich V, Khokhlov A, Kiss V, Kolář J, Kriiska A, Lasak I, Longhi C, McGlynn G, Merkevicius A, Merkyte I, Metspalu M, Mkrtchyan R, Moiseyev V, Paja L, Pálfi G, Pokutta D, Pospieszny Ł, Price TD, Saag L, Sablin M, Shishlina N, Smrčka V, Soenov VI, Szeverényi V, Tóth G, Trifanova SV, Varul L, Vicze M, Yepiskoposyan L, Zhitenev V, Orlando L, Sicheritz-Pontén T, Brunak S, Nielsen R, Kristiansen K, Willerslev E . 6 . Population genomics of Bronze Age Eurasia . Nature . 522 . 7555 . 167–72 . June 2015 . 26062507 . 10.1038/nature14507 . 4399103 . 2015Natur.522..167A .
  34. Web site: YFull The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon. 2021-01-24. yfull.com.
  35. Malmstrom H . July 2019. The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon. Uppsala Genomics. 1. 3. jakobssonlab.iob.uu.se/.
  36. Web site: I-Y11204 YTree .
  37. Sánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, George R, Hollfelder N, Burenhult G, Noble G, Britton K, Talamo S, Curtis N, Brzobohata H, Sumberova R, Götherström A, Storå J, Jakobsson M . 6 . Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society . Proceedings of the National Academy of Sciences of the United States of America . 116 . 19 . 9469–74 . May 2019 . 30988179 . 6511028 . 10.1073/pnas.1818037116 . 2019PNAS..116.9469S . free .
  38. Malmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, Holmlund G, Willerslev E, Jakobsson M, Lidén K, Götherström A . 6 . Ancient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion process . Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences . 370 . 1660 . 20130373 . January 2015 . 25487325 . 4275881 . 10.1098/rstb.2013.0373 .
  39. Karlsson AO, Wallerström T, Götherström A, Holmlund G . Y-chromosome diversity in Sweden – a long-time perspective . European Journal of Human Genetics . 14 . 8 . 963–70 . August 2006 . 16724001 . 10.1038/sj.ejhg.5201651 . 23227271 . free .
  40. Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, Pospieszny Ł, Tõrv M, Lindström J, Götherström A, Storå J, Jakobsson M . 6 . The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon . Proceedings. Biological Sciences . 286 . 1912 . 20191528 . October 2019 . 31594508 . 6790770 . 10.1098/rspb.2019.1528 .
  41. Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
  42. Poznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, Ayub Q, McCarthy SA, Narechania A, Kashin S, Chen Y, Banerjee R, Rodriguez-Flores JL, Cerezo M, Shao H, Gymrek M, Malhotra A, Louzada S, Desalle R, Ritchie GR, Cerveira E, Fitzgerald TW, Garrison E, Marcketta A, Mittelman D, Romanovitch M, Zhang C, Zheng-Bradley X, Abecasis GR, McCarroll SA, Flicek P, Underhill PA, Coin L, Zerbino DR, Yang F, Lee C, Clarke L, Auton A, Erlich Y, Handsaker RE, Bustamante CD, Tyler-Smith C . 6 . Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences . Nature Genetics . 48 . 6 . 593–99 . June 2016 . 27111036 . 4884158 . 10.1038/ng.3559 . free . 11858/00-001M-0000-002A-F024-C .
  43. Woodley M . February 2017. Holocene selection for variants associated with cognitive ability: Comparing ancient and modern genomes.. 27 January 2021. biorxiv.org/. 10.1101/109678. 196631764. free.
  44. http://isogg.org/tree/ISOGG_HapgrpI.html ISOGG, Y-DNA Haplogroup I and its Subclades – 2017
  45. Schmidt KH . 1991. The Celts and the Ethnogenesis of the Germanic People. Historische Sprachforschung / Historical Linguistics. 104. 1. 129–52. 40849016. 0935-3518.
  46. Bergerbrant S . May 2007. Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC. Stockholm Studies in Archaeology. 43. 7–201. diva-portal.org.
  47. Teska M, Michalowski A . 2014. Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron . Archaeologia Lituana . 14 . 63–77 . 10.15388/ArchLit.2013.0.2641 . 56295624 . free .
  48. Zenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M . 2017 . Y-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA Libraries . Anthropological Genetics . Presentation number: AG 16 .
  49. Amorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, La Rocca MC, Mende B, Bobo D, Pohl W, Baricco LP, Bedini E, Francalacci P, Giostra C, Vida T, Winger D, von Freeden U, Ghirotto S, Lari M, Barbujani G, Krause J, Caramelli D, Geary PJ, Veeramah KR . 6 . Understanding 6th-century barbarian social organization and migration through paleogenomics . Nature Communications . 9 . 1 . 3547 . September 2018 . 30206220 . 6134036 . 10.1038/s41467-018-06024-4 . 2018NatCo...9.3547A .
  50. Web site: Estes R . 2020-10-16. Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?. 2020-12-11. DNAeXplained – Genetic Genealogy.
  51. Labudde D . July 2015. Gender distribution of excavation finds from the Roman imperial and migration period. ResearchGate . 1 . 2 . ResearchGate.net.
  52. Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, Oberreiter V, Calderon D, Devitofranceschi K, Aikens RC, Aneli S, Bartoli F, Bedini A, Cheronet O, Cotter DJ, Fernandes DM, Gasperetti G, Grifoni R, Guidi A, La Pastina F, Loreti E, Manacorda D, Matullo G, Morretta S, Nava A, Fiocchi Nicolai V, Nomi F, Pavolini C, Pentiricci M, Pergola P, Piranomonte M, Schmidt R, Spinola G, Sperduti A, Rubini M, Bondioli L, Coppa A, Pinhasi R, Pritchard JK . 6 . Ancient Rome: A genetic crossroads of Europe and the Mediterranean . Science . 366 . 6466 . 708–14 . November 2019 . 31699931 . 7093155 . 10.1126/science.aay6826 . 2019Sci...366..708A .
  53. Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, Dulias K, Edwards CJ, Gandini F, Pala M, Soares P, Ferrando-Bernal M, Adamski N, Broomandkhoshbacht N, Cheronet O, Culleton BJ, Fernandes D, Lawson AM, Mah M, Oppenheimer J, Stewardson K, Zhang Z, Jiménez Arenas JM, Toro Moyano IJ, Salazar-García DC, Castanyer P, Santos M, Tremoleda J, Lozano M, García Borja P, Fernández-Eraso J, Mujika-Alustiza JA, Barroso C, Bermúdez FJ, Viguera Mínguez E, Burch J, Coromina N, Vivó D, Cebrià A, Fullola JM, García-Puchol O, Morales JI, Oms FX, Majó T, Vergès JM, Díaz-Carvajal A, Ollich-Castanyer I, López-Cachero FJ, Silva AM, Alonso-Fernández C, Delibes de Castro G, Jiménez Echevarría J, Moreno-Márquez A, Pascual Berlanga G, Ramos-García P, Ramos-Muñoz J, Vijande Vila E, Aguilella Arzo G, Esparza Arroyo Á, Lillios KT, Mack J, Velasco-Vázquez J, Waterman A, Benítez de Lugo Enrich L, Benito Sánchez M, Agustí B, Codina F, de Prado G, Estalrrich A, Fernández Flores Á, Finlayson C, Finlayson G, Finlayson S, Giles-Guzmán F, Rosas A, Barciela González V, García Atiénzar G, Hernández Pérez MS, Llanos A, Carrión Marco Y, Collado Beneyto I, López-Serrano D, Sanz Tormo M, Valera AC, Blasco C, Liesau C, Ríos P, Daura J, de Pedro Michó MJ, Diez-Castillo AA, Flores Fernández R, Francès Farré J, Garrido-Pena R, Gonçalves VS, Guerra-Doce E, Herrero-Corral AM, Juan-Cabanilles J, López-Reyes D, McClure SB, Merino Pérez M, Oliver Foix A, Sanz Borràs M, Sousa AC, Vidal Encinas JM, Kennett DJ, Richards MB, Werner Alt K, Haak W, Pinhasi R, Lalueza-Fox C, Reich D . 6 . The genomic history of the Iberian Peninsula over the past 8000 years . Science . 363 . 6432 . 1230–34 . March 2019 . 30872528 . 6436108 . 10.1126/science.aav4040 . 2019Sci...363.1230O .
  54. Martiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, McLaughlin RL, Teasdale MD, van Rheenen W, Veldink JH, van den Berg LH, Hardiman O, Carroll M, Roskams S, Oxley J, Morgan C, Thomas MG, Barnes I, McDonnell C, Collins MJ, Bradley DG . 6 . Genomic signals of migration and continuity in Britain before the Anglo-Saxons . Nature Communications . 7 . 1 . 10326 . January 2016 . 26783717 . 4735653 . 10.1038/ncomms10326 . 2016NatCo...710326M .
  55. Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, Cassidy LM, Jørsboe E, Ingason A, Pedersen MW, Korneliussen T, Wilhelmson H, Buś MM, de Barros Damgaard P, Martiniano R, Renaud G, Bhérer C, Moreno-Mayar JV, Fotakis AK, Allen M, Allmäe R, Molak M, Cappellini E, Scorrano G, McColl H, Buzhilova A, Fox A, Albrechtsen A, Schütz B, Skar B, Arcini C, Falys C, Jonson CH, Błaszczyk D, Pezhemsky D, Turner-Walker G, Gestsdóttir H, Lundstrøm I, Gustin I, Mainland I, Potekhina I, Muntoni IM, Cheng J, Stenderup J, Ma J, Gibson J, Peets J, Gustafsson J, Iversen KH, Simpson L, Strand L, Loe L, Sikora M, Florek M, Vretemark M, Redknap M, Bajka M, Pushkina T, Søvsø M, Grigoreva N, Christensen T, Kastholm O, Uldum O, Favia P, Holck P, Sten S, Arge SV, Ellingvåg S, Moiseyev V, Bogdanowicz W, Magnusson Y, Orlando L, Pentz P, Jessen MD, Pedersen A, Collard M, Bradley DG, Jørkov ML, Arneborg J, Lynnerup N, Price N, Gilbert MT, Allentoft ME, Bill J, Sindbæk SM, Hedeager L, Kristiansen K, Nielsen R, Werge T, Willerslev E . 6 . Population genomics of the Viking world . Nature . 585 . 7825 . 390–96 . September 2020 . 32939067 . 10.1038/s41586-020-2688-8. 2020Natur.585..390M . 10.1101/703405 . 201195157 . 10852/83989 . free .
  56. Weale ME, Weiss DA, Jager RF, Bradman N, Thomas MG . Y chromosome evidence for Anglo-Saxon mass migration . Molecular Biology and Evolution . 19 . 7 . 1008–21 . July 2002 . 12082121 . 10.1093/oxfordjournals.molbev.a004160 . free .
  57. Capelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, Hervig T, Richards M, Stumpf MP, Underhill PA, Bradshaw P, Shaha A, Thomas MG, Bradman N, Goldstein DB . 6 . A Y chromosome census of the British Isles . Current Biology . 13 . 11 . 979–84 . May 2003 . 12781138 . 10.1016/S0960-9822(03)00373-7 . 526263 . 20.500.11820/8acb01f3-a7c1-45f5-89de-b796266d651e . free .
  58. Web site: Founding Father DNA. isogg.org.
  59. Web site: FamilyTreeDNA – Genetic Testing for Ancestry, Family History & Genealogy. 2020-12-10. familytreedna.com.
  60. Web site: Faderslinjen, DNA. 2020-12-10. sikaby.se.
  61. Web site: FamilyTreeDNA – RussiaDNA Project. 2020-12-10. familytreedna.com.
  62. Web site: Vår vikingahövding i österled. 2020-12-10. sikaby.se.
  63. Web site: Sample from Homo sapiens – BioSample – NCBI. 2020-12-10. ncbi.nlm.nih.gov.
  64. Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, Cassidy LM, Jørsboe E, Ingason A, Pedersen MW, Korneliussen T, Wilhelmson H, Buś MM, de Barros Damgaard P, Martiniano R, Renaud G, Bhérer C, Moreno-Mayar JV, Fotakis AK, Allen M, Allmäe R, Molak M, Cappellini E, Scorrano G, McColl H, Buzhilova A, Fox A, Albrechtsen A, Schütz B, Skar B, Arcini C, Falys C, Jonson CH, Błaszczyk D, Pezhemsky D, Turner-Walker G, Gestsdóttir H, Lundstrøm I, Gustin I, Mainland I, Potekhina I, Muntoni IM, Cheng J, Stenderup J, Ma J, Gibson J, Peets J, Gustafsson J, Iversen KH, Simpson L, Strand L, Loe L, Sikora M, Florek M, Vretemark M, Redknap M, Bajka M, Pushkina T, Søvsø M, Grigoreva N, Christensen T, Kastholm O, Uldum O, Favia P, Holck P, Sten S, Arge SV, Ellingvåg S, Moiseyev V, Bogdanowicz W, Magnusson Y, Orlando L, Pentz P, Jessen MD, Pedersen A, Collard M, Bradley DG, Jørkov ML, Arneborg J, Lynnerup N, Price N, Gilbert MT, Allentoft ME, Bill J, Sindbæk SM, Hedeager L, Kristiansen K, Nielsen R, Werge T, Willerslev E . 6 . Population genomics of the Viking world . Nature . 585 . 7825 . 390–96 . September 2020 . 32939067 . 10.1038/s41586-020-2688-8 . 2020Natur.585..390M . 10852/83989 . 221769227 . free .
  65. Book: Duczko W . Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe. 2004. Brill. 978-90-04-13874-2.
  66. Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, Willerslev E, Holmlund G, Götherström A . 6 . Finding the founder of Stockholm – a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA . Annals of Anatomy – Anatomischer Anzeiger . 194 . 1 . 138–45 . January 2012 . 21596538 . 10.1016/j.aanat.2011.03.014 . Special Issue: Ancient DNA .
  67. https://www.pbs.org/video/finding-your-roots-british-invasion/ The British Invasion
  68. Web site: Mayflower DNA Project. 2020-11-23. mayflowerdna.org.
  69. Web site: FamilyTreeDNA – Lee Surname DNA Research Project (and Leigh, Lea, etc). 2020-12-10. familytreedna.com.
  70. Web site: FamilyTreeDNA – Grimaldi Genealogy Project at FtDNA. 2020-12-11. familytreedna.com.
  71. Web site: 11 December 2020. Jackson DNA Project. FamilyTreeDNA.
  72. Hay M . July 2020. Origins and history of Haplogroup I1 (Y-DNA). ResearchGate. 1. 9.
  73. Web site: Maciamo E . Haplogroup I1 (Y-DNA). 2020-12-11. Eupedia.
  74. Web site: I-BY229 YTree. 2020-12-10. yfull.com.
  75. Web site: Swedenborg. 2020-12-10. Höijen. sv-SE. 2020-10-26. https://web.archive.org/web/20201026061910/https://hoijen.se/cat/dna/swedenborg/. dead.
  76. Web site: Claas Jansz van Rensburg, SV/PROG. 2021-01-03. geni_family_tree.
  77. Web site: janse /jansen van Rensburg I-M253 genealogy discussion. 2021-01-03. geni_family_tree.
  78. Web site: Rolf H. Nevanlinna. 2020-12-26. geni_family_tree.
  79. Web site: olenus. 2018-03-30. I1: Rolf Nevanlinna (né Neovius). 2020-12-26. Descendants of haplogroup IJ-M429.
  80. Web site: Arne Edvard Nevanlinna. 2020-12-26. geni_family_tree.
  81. Web site: Morse/Moss DNA Testing. 2020-12-10. morsesociety.org.
  82. Web site: FamilyTreeDNA – Morse / Moss DNA Project. 2020-12-10. familytreedna.com.
  83. Web site: Peter Morse's Family Tree. 2020-12-10. geni.com.
  84. Web site: FamilyTreeDNA – Sweden DNA Project – Sverigeprojektet. 2021-02-14. familytreedna.com.
  85. Web site: Eskilstuna kommun · EM GN398 – Familjen Larsson, Torshälla ca 1900. 2021-02-14. Eskilstuna kommun. sv-SE.
  86. Web site: I-Y24470 YTree. 2021-02-14. yfull.com.
  87. Web site: Familjen Larssons Anfäder . 2021-02-14. hosserudkullen.se.
  88. Archived at Ghostarchive and the Wayback Machine: Web site: I Did A DNA Test... (I Guess Im Cancelled Now) . YouTube.
  89. Web site: FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet. 2021-02-02. familytreedna.com.
  90. Web site: Tovseth A . June 2018. Andrésen, Färnskog & Hansen family research. 2 February 2021. Kjellivar.tripod.com.
  91. Web site: Personer med namnet Andresen Släktingar.se. 2021-02-02. slaktingar.se.
  92. Web site: Radio Sveriges . Björn Andresen: Min passion för mamma blev aldrig besvarad – Katarina Hahr möter. 2021-02-02 . sv.
  93. Web site: Johan Peter Andresen – Ancestry. 2021-02-02. ancestry.se.
  94. Web site: Family tree of Daniel Andresen . 2021-02-02. Geneanet.
  95. Web site: FamilyTreeDNA – Pine/Pyne Genealogy DNA Project. 2020-12-10. familytreedna.com.
  96. Web site: James Pine, Sr.. 2020-12-10. geni_family_tree.
  97. News: Bianca Salming om relationen med Börje: "Känner mig hemsk" . sv . Bianca Salming on her relationship with Börje: "Feeling awful" . Janlind F . 20 February 2021 . Goteborgs-Posten.
  98. Web site: Mercedes . 2023-03-26 . Beethoven DNA Discovery – Find Out If You Are Related . 2023-10-07 . Who are You Made Of?.
  99. Web site: Reference SNP (refSNP) Cluster Report: rs9341296 . snpdev. nih.gov.
  100. Web site: Reference SNP (refSNP) Cluster Report: rs13447354 . snpdev. nih.gov.
  101. http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=P30;class=Sequence;ref=ChrY;start=13006761;end=13006761 P30
  102. http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=P40;class=Sequence;ref=ChrY;start=12994402;end=12994402 P40

This article is licensed under the GNU Free Documentation License. It uses material from the Wikipedia article "Haplogroup I-M253".

Except where otherwise indicated, Everything.Explained.Today is © Copyright 2009-2024, A B Cryer, All Rights Reserved. Cookie policy.