Congenital stationary night blindness explained

Congenital stationary night blindness

Congenital stationary night blindness (CSNB) is a rare non-progressive retinal disorder. People with CSNB often have difficulty adapting to low light situations due to impaired photoreceptor transmission. These patients may also have reduced visual acuity, myopia, nystagmus, fundus abnormalities, and strabismus.[1] [2] CSNB has two forms -- complete, also known as type-1 (CSNB1), and incomplete, also known as type-2 (CSNB2), which are distinguished by the involvement of different retinal pathways. In CSNB1, downstream neurons called bipolar cells are unable to detect neurotransmission from photoreceptor cells. CSNB1 can be caused by mutations in various genes involved in neurotransmitter detection, including NYX. In CSNB2, the photoreceptors themselves have impaired neurotransmission function; this is caused primarily by mutations in the gene CACNA1F, which encodes a voltage-gated calcium channel important for neurotransmitter release. CSNB has been identified in horses and dogs as the result of mutations in TRPM1 (Horse, "LP")[3] , GRM6 (Horse, "CSNB2")[4], and LRIT3 (Dog, CSNB)[5] .

Congenital stationary night blindness (CSNB) can be inherited in an X-linked, autosomal dominant, or autosomal recessive pattern, depending on the genes involved.

Two forms of CSNB can also affect horses, one linked to the leopard complex of equine coat colors and the other found in certain horse breeds. Both are autosomal recessives.[6] [7]

Symptoms and signs

The X-linked varieties of congenital stationary night blindness (CSNB) can be differentiated from the autosomal forms by the presence of myopia, which is typically absent in the autosomal forms. Patients with CSNB often have impaired night vision, myopia, reduced visual acuity, strabismus and nystagmus. Individuals with the complete form of CSNB (CSNB1) have highly impaired rod sensitivity (reduced ~300x) as well as cone dysfunction. Patients with the incomplete form can present with either myopia or hyperopia.[8]

Cause

CSNB is caused by malfunctions in neurotransmission from rod and cone photoreceptors to bipolar cells in the retina.[9] At this first synapse, information from photoreceptors is divided into two channels: ON and OFF. The ON pathway detects light onset, while the OFF pathway detects light offset.[10] The malfunctions in CSNB1 specifically affect the ON pathway, by hindering the ability of ON-type bipolar cells to detect neurotransmitter released from photoreceptors.[9] Rods, which are responsible for low-light vision, make contacts with ON-type bipolar cells only, while, cones, which are responsible for bright-light vision, make contacts with bipolar cells of both ON an OFF subtypes.[11] Because the low-light sensing rods feed only into the ON pathway, individuals with CSNB1 typically have problems with night vision, while vision in well-lit conditions is spared.[9] In CSNB2, release of neurotransmitter from photoreceptors is impaired, leading to involvement of both ON and OFF pathways.

The electroretinogram (ERG) is an important tool for diagnosing CSNB. The ERG a-wave, which reflects the function of the phototransduction cascade in response to a light flashes, is typically normal in CSNB patients, although in some cases phototransduction is also affected, leading to a reduced a-wave. The ERG b-wave, which primarily reflects the function of ON-bipolar cells, is greatly reduced in CSNB2 cases, and completely absent in CSNB1 cases.[9] [12]

Genetics

Only three rhodopsin mutations have been found associated with congenital stationary night blindness (CSNB).[13] Two of these mutations are found in the second transmembrane helix of rhodopsin at Gly-90 and Thr-94. Specifically, these mutations are the Gly90Asp [14] and the Thr94Ile, which has been the most recent one reported.[15] The third mutation is Ala292Glu, and it is located in the seventh transmembrane helix, in proximity to the site of retinal attachment at Lys-296.[16] Mutations associated with CSNB affect amino acid residues near the protonated Schiff base (PSB) linkage. They are associated with changes in conformational stability and the protonated status of the PSB nitrogen.[17]

Pathophysiology

CSNB1

The complete form of X-linked congenital stationary night blindness, also known as nyctalopia, is caused by mutations in the NYX gene (Nyctalopin on X-chromosome), which encodes a small leucine-rich repeat (LRR) family protein of unknown function.[18] [19] This protein consists of an N-terminal signal peptide and 11 LRRs (LRR1-11) flanked by cysteine-rich LRRs (LRRNT and LRRCT). At the C-terminus of the protein there is a putative GPI anchor site. Although the function of NYX is yet to be fully understood, it is believed to be located extracellularly. A naturally occurring deletion of 85 bases in NYX in some mice leads to the "nob" (no b-wave) phenotype, which is highly similar to that seen in CSNB1 patients.[20] NYX is expressed primarily in the rod and cone cells of the retina. There are currently almost 40 known mutations in NYX associated with CSNB1, Table 1., located throughout the protein. As the function of the nyctalopin protein is unknown, these mutations have not been further characterized. However, many of them are predicted to lead to truncated proteins that, presumably, are non-functional.

Table 1. Mutations in NYX associated with CSNB1
MutationPositionReferences
NucleotideAmino acid
c.?-1_?-61del1_20delSignal sequence
SplicingIntron 1[21]
c.?-63_1443-?del21_481del
c.48_64delL18RfsX108Signal sequence
c.85_108delR29_A36delN-terminal LRR
c.G91CC31SLRRNT
c.C105AC35XLRRNT
c.C169AP57TLRRNT[22]
c.C191AA64ELRR1
c.G281CR94PLRR2[23]
c.301_303delI101delLRR2
c.T302CI101TLRR2
c.340_351delE114_A118delLRR3
c.G427CA143PLRR4
c.C452TP151LLRR4
c.464_465insAGCGTGCCCGAGCGCCTCCTGS149_V150dup+P151_L155dupLRR4
c.C524GP175RLRR5
c.T551CL184PLRR6
c.556_618delinsH186?fsX260LRR6
c.559_560delinsAAA187KLRR6
c.613_621dup205_207dupLRR7
c.628_629insR209_S210insCLRLRR7
c.T638AL213QLRR7
c.A647GN216SLRR7
c.T695CL232PLRR8
c.727_738del243_246delLRR8
c.C792GN264KLRR9
c.T854CL285PLRR10
c.T893CF298SLRR10
c.C895TQ299XLRR10
c.T920CL307PLRR11
c.A935GN312SLRR11
c.T1040CL347PLRRCT
c.G1049AW350XLRRCT
c.G1109TG370VLRRCT
c.1122_1457delS374RfsX383LRRCT
c.1306delL437WfsX559C-terminus
LRR: leucine-rich repeat, LRRNT and LRRCT: N- and C-terminal cysteine-rich LRRs.

CSNB2

The incomplete form of X-linked congenital stationary night blindness (CSNB2) is caused by mutations in the CACNA1F gene, which encodes the voltage-gated calcium channel CaV1.4 expressed heavily in retina.[24] [25] One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca2+ entry upon depolarization. As photoreceptors depolarize in the absence of light, CaV1.4 channels operate to provide sustained neurotransmitter release upon depolarization.[26] This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals.[27] There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.

Table 2. Mutations in CACNA1F associated with CSNB2
MutationPositionEffectReferences
NucleotideAmino Acid
c.C148T ! R50X N-terminus [28]
c.151_155delAGAAA ! R51PfsX115 N-terminus [29]
c.T220C ! C74R N-terminus
c.C244T ! R82X N-terminus
c.466_469delinsGTAGGGGTGCT
CCACCCCGTAGGGGTGCTCCACC ! S156VdelPinsGVKHOVGVLH 		D1S2-3 [30] [31]
! Splicing Intron 4
c.T685C ! S229P D1S4-5
c.G781A ! G261R D1-pore
c.G832T ! E278X D1-pore [32]
c.904insG ! R302AfsX314 D1-pore
c.951_953delCTT ! F318del D1-pore
c.G1106A ! G369D D1S6 Activates ~20mV more negative than wild-type, increases time to peak current and decreases inactivation, increased Ca2+ permeability. [33]
c.1218delC ! W407GfsX443 D1-2
c.C1315T ! Q439X D1-2
c.G1556A ! R519Q D1-2 Decreased expression [34]
c.C1873T ! R625X D2S4
c.G2021A ! G674D D2S5
c.C2071T ! R691X D2-pore
c.T2258G ! F753C D2S6
c.T2267C ! I756T D2S6 Activates ~35mV more negative than wild-type, inactivates more slowly [35]
! Splicing Intron 19
c.T2579C ! L860P D2-3
c.C2683T ! R895X D3S1-2
! Splicing Intron 22
! Splicing Intron 22
c.C2783A ! A928D D3S2-3
c.C2905T ! R969X D3S4
c.C2914T ! R972X D3S4
! Splicing Intron24
c.C2932T ! R978X D3S4
c.3006_3008delCAT ! I1003del D3S4-5
c.G3052A ! G1018R D3S5
c.3125delG ! G1042AfsX1076 D3-pore
c.3166insC ! L1056PfsX1066 D3-pore
c.C3178T ! R1060W D3-pore
c.T3236C ! L1079P D3-pore Does not open without BayK, activates ~5mV more negative than wild-type
c.3672delC ! L1225SfsX1266 D4S2
c.3691_3702del ! G1231_T1234del D4S2
c.G3794T ! S1265I D4S3
c.C3886A ! R1296S D4S4
c.C3895T ! R1299X D4S4
! Splicing Intron 32
c.C4075T ! Q1359X D4-pore
c.T4124A ! L1375H D4-pore Decreased expression
! Splicing Intron 35
c.G4353A ! W1451X C-terminus Non-functional
c.T4495C ! C1499R C-terminus
c.C4499G ! P1500R C-terminus
c.T4523C ! L1508P C-terminus
! Splicing intron 40
c.4581delC ! F1528LfsX1535 C-terminus [36]
c.A4804T ! K1602X C-terminus
c.C5479T ! R1827X C-terminus
c.5663delG ! S1888TfsX1931 C-terminus
c.G5789A ! R1930H C-terminus

Diagnosis

Night blindness is a symptom in many patients and diagnosis often occurs through the use of various tests including a electroretinogram to reveal any impairment in the retina "as a whole".[37] [38] Tests performed can also include a visual field examination, Fundoscopic examination, and slit-lamp microscopy in addition to measurements provided by the electroretinogram (ERG).[39] [40] [41]

External links

Notes and References

  1. Bai . Dong'e . Guo . Ruru . Huang . Dandan . Ji . Jian . Liu . Wei . 2024-03-15 . Compound heterozygous mutations in GRM6 causing complete Schubert-Bornschein type congenital stationary night blindness . Heliyon . 10 . 5 . e27039 . 10.1016/j.heliyon.2024.e27039 . free . 2405-8440 . 10907788 . 38434377. 2024Heliy..1027039B .
  2. Zeitz . Christina . Robson . Anthony G. . Audo . Isabelle . 2015-03-01 . Congenital stationary night blindness: An analysis and update of genotype–phenotype correlations and pathogenic mechanisms . Progress in Retinal and Eye Research . 45 . 58–110 . 10.1016/j.preteyeres.2014.09.001 . 25307992 . 1350-9462.
  3. Bellone RR, Holl H, Setaluri V, Devi S, Maddodi N, Archer S, Sandmeyer L, Ludwig A, Foerster D, Pruvost M, Reissmann M, Bortfeldt R, Adelson DL, Lim SL, Nelson J, Haase B, Engensteiner M, Leeb T, Forsyth G, Mienaltowski MJ, Mahadevan P, Hofreiter M, Paijmans JL, Gonzalez-Fortes G, Grahn B, Brooks SA . 6 . Evidence for a retroviral insertion in TRPM1 as the cause of congenital stationary night blindness and leopard complex spotting in the horse . PLOS ONE . 8 . 10 . e78280 . 2013-10-22 . 24167615 . 3805535 . 10.1371/journal.pone.0078280 . 2013PLoSO...878280B . free .
  4. Hack YL, Crabtree EE, Avila F, Sutton RB, Grahn R, Oh A, Gilger B, Bellone RR . 6 . Whole-genome sequencing identifies missense mutation in GRM6 as the likely cause of congenital stationary night blindness in a Tennessee Walking Horse . Equine Veterinary Journal . 53 . 2 . 316–323 . March 2021 . 32654228 . 10.1111/evj.13318 . 220500585 . free .
  5. Das RG, Becker D, Jagannathan V, Goldstein O, Santana E, Carlin K, Sudharsan R, Leeb T, Nishizawa Y, Kondo M, Aguirre GD, Miyadera K . 6 . Genome-wide association study and whole-genome sequencing identify a deletion in LRIT3 associated with canine congenital stationary night blindness . Scientific Reports . 9 . 1 . 14166 . October 2019 . 31578364 . 6775105 . 10.1038/s41598-019-50573-7 . 2019NatSR...914166D .
  6. Web site: Appaloosa Panel 2 Veterinary Genetics Laboratory . vgl.ucdavis.edu . 11 October 2022.
  7. Web site: Congenital Stationary Night Blindness (CSNB2) in Tennessee Walking Horses Veterinary Genetics Laboratory . vgl.ucdavis.edu . 11 October 2022 . en.
  8. Boycott KM, Pearce WG, Musarella MA, Weleber RG, Maybaum TA, Birch DG, Miyake Y, Young RS, Bech-Hansen NT . 6 . Evidence for genetic heterogeneity in X-linked congenital stationary night blindness . American Journal of Human Genetics . 62 . 4 . 865–875 . April 1998 . 9529339 . 1377021 . 10.1086/301781 .
  9. Zeitz C, Robson AG, Audo I . Congenital stationary night blindness: an analysis and update of genotype-phenotype correlations and pathogenic mechanisms . Progress in Retinal and Eye Research . 45 . 58–110 . March 2015 . 25307992 . 10.1016/j.preteyeres.2014.09.001 . 45696921 .
  10. Euler T, Haverkamp S, Schubert T, Baden T . Retinal bipolar cells: elementary building blocks of vision . Nature Reviews. Neuroscience . 15 . 8 . 507–519 . August 2014 . 25158357 . 10.1038/nrn3783 . 16309488 .
  11. Dunn FA, Wong RO . Wiring patterns in the mouse retina: collecting evidence across the connectome, physiology and light microscopy . The Journal of Physiology . 592 . 22 . 4809–4823 . November 2014 . 25172948 . 4259528 . 10.1113/jphysiol.2014.277228 .
  12. Audo I, Robson AG, Holder GE, Moore AT . The negative ERG: clinical phenotypes and disease mechanisms of inner retinal dysfunction . Survey of Ophthalmology . 53 . 1 . 16–40 . 2008 . 18191655 . 10.1016/j.survophthal.2007.10.010 .
  13. Garriga P, Manyosa J . The eye photoreceptor protein rhodopsin. Structural implications for retinal disease . FEBS Letters . 528 . 1–3 . 17–22 . September 2002 . 12297272 . 10.1016/s0014-5793(02)03241-6 . 41860711 .
  14. Rao VR, Cohen GB, Oprian DD . Rhodopsin mutation G90D and a molecular mechanism for congenital night blindness . Nature . 367 . 6464 . 639–42 . February 1994 . 8107847 . 10.1038/367639a0 . 1994Natur.367..639R . 4311079 .
  15. N. al-Jandal, G.J. Farrar, A.S. Kiang, M.M. Humphries, N. Bannon, J.B. Findlay, P. Humphries and P.F. Kenna Hum. Mutat. 13 (1999), pp. 75–81.
  16. Dryja TP, Berson EL, Rao VR, Oprian DD . Heterozygous missense mutation in the rhodopsin gene as a cause of congenital stationary night blindness . Nature Genetics . 4 . 3 . 280–3 . July 1993 . 8358437 . 10.1038/ng0793-280 . 7682929 .
  17. Sieving PA, Richards JE, Naarendorp F, Bingham EL, Scott K, Alpern M . Dark-light: model for nightblindness from the human rhodopsin Gly-90→Asp mutation . Proceedings of the National Academy of Sciences of the United States of America . 92 . 3 . 880–4 . January 1995 . 7846071 . 42724 . 10.1073/pnas.92.3.880 . 1995PNAS...92..880S . free .
  18. Bech-Hansen NT, Naylor MJ, Maybaum TA, Sparkes RL, Koop B, Birch DG, Bergen AA, Prinsen CF, Polomeno RC, Gal A, Drack AV, Musarella MA, Jacobson SG, Young RS, Weleber RG . 6 . Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness . Nature Genetics . 26 . 3 . 319–323 . November 2000 . 11062471 . 10.1038/81619 . 10223880 .
  19. Pusch CM, Zeitz C, Brandau O, Pesch K, Achatz H, Feil S, Scharfe C, Maurer J, Jacobi FK, Pinckers A, Andreasson S, Hardcastle A, Wissinger B, Berger W, Meindl A . 6 . The complete form of X-linked congenital stationary night blindness is caused by mutations in a gene encoding a leucine-rich repeat protein . Nature Genetics . 26 . 3 . 324–327 . November 2000 . 11062472 . 10.1038/81627 . 42428370 .
  20. Gregg RG, Mukhopadhyay S, Candille SI, Ball SL, Pardue MT, McCall MA, Peachey NS . Identification of the gene and the mutation responsible for the mouse nob phenotype . Investigative Ophthalmology & Visual Science . 44 . 1 . 378–384 . January 2003 . 12506099 . 10.1167/iovs.02-0501 . free .
  21. Zito I, Allen LE, Patel RJ, Meindl A, Bradshaw K, Yates JR, Bird AC, Erskine L, Cheetham ME, Webster AR, Poopalasundaram S, Moore AT, Trump D, Hardcastle AJ . 6 . Mutations in the CACNA1F and NYX genes in British CSNBX families . Human Mutation . 21 . 2 . 169 . February 2003 . 12552565 . 10.1002/humu.9106 . 13143864 .
  22. Zeitz C, Minotti R, Feil S, Mátyás G, Cremers FP, Hoyng CB, Berger W . Novel mutations in CACNA1F and NYX in Dutch families with X-linked congenital stationary night blindness . Molecular Vision . 11 . 179–183 . March 2005 . 15761389 .
  23. Xiao X, Jia X, Guo X, Li S, Yang Z, Zhang Q . CSNB1 in Chinese families associated with novel mutations in NYX . Journal of Human Genetics . 51 . 7 . 634–640 . 2006 . 16670814 . 10.1007/s10038-006-0406-5 . free .
  24. Strom TM, Nyakatura G, Apfelstedt-Sylla E, Hellebrand H, Lorenz B, Weber BH, Wutz K, Gutwillinger N, Rüther K, Drescher B, Sauer C, Zrenner E, Meitinger T, Rosenthal A, Meindl A . 6 . An L-type calcium-channel gene mutated in incomplete X-linked congenital stationary night blindness . Nature Genetics . 19 . 3 . 260–263 . July 1998 . 9662399 . 10.1038/940 . 34467174 .
  25. Bech-Hansen NT, Naylor MJ, Maybaum TA, Pearce WG, Koop B, Fishman GA, Mets M, Musarella MA, Boycott KM . 6 . Loss-of-function mutations in a calcium-channel alpha1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness . Nature Genetics . 19 . 3 . 264–267 . July 1998 . 9662400 . 10.1038/947 . 42480901 .
  26. McRory JE, Hamid J, Doering CJ, Garcia E, Parker R, Hamming K, Chen L, Hildebrand M, Beedle AM, Feldcamp L, Zamponi GW, Snutch TP . 6 . The CACNA1F gene encodes an L-type calcium channel with unique biophysical properties and tissue distribution . The Journal of Neuroscience . 24 . 7 . 1707–1718 . February 2004 . 14973233 . 6730460 . 10.1523/JNEUROSCI.4846-03.2004 . free .
  27. Mansergh F, Orton NC, Vessey JP, Lalonde MR, Stell WK, Tremblay F, Barnes S, Rancourt DE, Bech-Hansen NT . 6 . Mutation of the calcium channel gene Cacna1f disrupts calcium signaling, synaptic transmission and cellular organization in mouse retina . Human Molecular Genetics . 14 . 20 . 3035–3046 . October 2005 . 16155113 . 10.1093/hmg/ddi336 . free .
  28. Boycott KM, Maybaum TA, Naylor MJ, Weleber RG, Robitaille J, Miyake Y, Bergen AA, Pierpont ME, Pearce WG, Bech-Hansen NT . 6 . A summary of 20 CACNA1F mutations identified in 36 families with incomplete X-linked congenital stationary night blindness, and characterization of splice variants . Human Genetics . 108 . 2 . 91–97 . February 2001 . 11281458 . 10.1007/s004390100461 . 2844173 .
  29. Wutz K, Sauer C, Zrenner E, Lorenz B, Alitalo T, Broghammer M, Hergersberg M, de la Chapelle A, Weber BH, Wissinger B, Meindl A, Pusch CM . 6 . Thirty distinct CACNA1F mutations in 33 families with incomplete type of XLCSNB and Cacna1f expression profiling in mouse retina . European Journal of Human Genetics . 10 . 8 . 449–456 . August 2002 . 12111638 . 10.1038/sj.ejhg.5200828 . free .
  30. Nakamura M, Ito S, Terasaki H, Miyake Y . Novel CACNA1F mutations in Japanese patients with incomplete congenital stationary night blindness . Investigative Ophthalmology & Visual Science . 42 . 7 . 1610–1616 . June 2001 . 11381068 .
  31. Nakamura M, Ito S, Piao CH, Terasaki H, Miyake Y . Retinal and optic disc atrophy associated with a CACNA1F mutation in a Japanese family . Archives of Ophthalmology . 121 . 7 . 1028–1033 . July 2003 . 12860808 . 10.1001/archopht.121.7.1028 .
  32. Allen LE, Zito I, Bradshaw K, Patel RJ, Bird AC, Fitzke F, Yates JR, Trump D, Hardcastle AJ, Moore AT . 6 . Genotype-phenotype correlation in British families with X linked congenital stationary night blindness . The British Journal of Ophthalmology . 87 . 11 . 1413–1420 . November 2003 . 14609846 . 1771890 . 10.1136/bjo.87.11.1413 .
  33. Hoda JC, Zaghetto F, Koschak A, Striessnig J . Congenital stationary night blindness type 2 mutations S229P, G369D, L1068P, and W1440X alter channel gating or functional expression of Ca(v)1.4 L-type Ca2+ channels . The Journal of Neuroscience . 25 . 1 . 252–259 . January 2005 . 15634789 . 6725195 . 10.1523/JNEUROSCI.3054-04.2005 . free .
  34. Hoda JC, Zaghetto F, Singh A, Koschak A, Striessnig J . Effects of congenital stationary night blindness type 2 mutations R508Q and L1364H on Cav1.4 L-type Ca2+ channel function and expression . Journal of Neurochemistry . 96 . 6 . 1648–1658 . March 2006 . 16476079 . 10.1111/j.1471-4159.2006.03678.x . 25987619 .
  35. Hemara-Wahanui A, Berjukow S, Hope CI, Dearden PK, Wu SB, Wilson-Wheeler J, Sharp DM, Lundon-Treweek P, Clover GM, Hoda JC, Striessnig J, Marksteiner R, Hering S, Maw MA . 6 . A CACNA1F mutation identified in an X-linked retinal disorder shifts the voltage dependence of Cav1.4 channel activation . Proceedings of the National Academy of Sciences of the United States of America . 102 . 21 . 7553–7558 . May 2005 . 15897456 . 1140436 . 10.1073/pnas.0501907102 . free . 2005PNAS..102.7553H .
  36. Jacobi FK, Hamel CP, Arnaud B, Blin N, Broghammer M, Jacobi PC, Apfelstedt-Sylla E, Pusch CM . 6 . A novel CACNA1F mutation in a french family with the incomplete type of X-linked congenital stationary night blindness . American Journal of Ophthalmology . 135 . 5 . 733–736 . May 2003 . 12719097 . 10.1016/S0002-9394(02)02109-8 .
  37. Riggs . Lorrin A. . 1954-07-01 . Electroretinography in Cases of Night Blindness* . American Journal of Ophthalmology . 38 . 1 . 70–78 . 10.1016/0002-9394(54)90011-2 . 13180620 . 0002-9394.
  38. Henderson . Robert H. . 2020-01-01 . Inherited retinal dystrophies . Paediatrics and Child Health . 30 . 1 . 19–27 . 10.1016/j.paed.2019.10.004 . 1751-7222.
  39. Bai . Dong'e . Guo . Ruru . Huang . Dandan . Ji . Jian . Liu . Wei . 2024-03-15 . Compound heterozygous mutations in GRM6 causing complete Schubert-Bornschein type congenital stationary night blindness . Heliyon . 10 . 5 . e27039 . 10.1016/j.heliyon.2024.e27039 . free . 2405-8440 . 10907788 . 38434377. 2024Heliy..1027039B .
  40. Schubert . G. . Bornschein . H. . 2010-03-18 . Beitrag zur Analyse des menschlichen Elektroretinogramms . Ophthalmologica . 123 . 6 . 396–413 . 10.1159/000301211 . 14957416 . 0030-3755.
  41. Riggs . Lorrin A. . 1954-07-01 . Electroretinography in Cases of Night Blindness* . American Journal of Ophthalmology . 38 . 1 . 70–78 . 10.1016/0002-9394(54)90011-2 . 13180620 . 0002-9394.

This article is licensed under the GNU Free Documentation License. It uses material from the Wikipedia article "Congenital stationary night blindness".

Except where otherwise indicated, Everything.Explained.Today is © Copyright 2009-2024, A B Cryer, All Rights Reserved. Cookie policy.